ID   GU564449; SV 1; linear; genomic DNA; STD; PLN; 284 BP.
XX
AC   GU564449;
XX
DT   22-FEB-2011 (Rel. 107, Created)
DT   15-NOV-2011 (Rel. 110, Last updated, Version 2)
XX
DE   Rosa chinensis var. spontanea psbA-trnH intergenic spacer, complete
DE   sequence; chloroplast.
XX
KW   .
XX
OS   Rosa chinensis var. spontanea
OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
OC   Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae;
OC   rosids; fabids; Rosales; Rosaceae; Rosoideae; Rosoideae incertae sedis;
OC   Rosa.
OG   Plastid:Chloroplast
XX
RN   [1]
RP   1-284
RX   AGRICOLA; IND44817822.
RA   Meng J., Fougere-Danezan M., Zhang L.-B., Li D.-Z., Yi T.-S.;
RT   "Untangling the hybrid origin of the Chinese tea roses: evidence from DNA
RT   sequences of single-copy nuclear and chloroplast genes";
RL   Plant Syst. Evol. 297(3-4):157-170(2011).
XX
RN   [2]
RP   1-284
RA   Fougere-Danezan M., Zhang L.-B., Gao X.;
RT   "Phylogenetic relationships in the genus Rosa: what tell us the Chinese
RT   roses?";
RL   Unpublished.
XX
RN   [3]
RP   1-284
RA   Meng J., Fougere-Danezan M., Zhang L.-B., Li D., Yi T.;
RT   "Hybrid origin of three varieties of the double-petaled Rosa odorata
RT   (Rosaceae)";
RL   Unpublished.
XX
RN   [4]
RP   1-284
RA   Fougere-Danezan M., Zhang L.-B., Gao X.;
RT   ;
RL   Submitted (14-JAN-2010) to the INSDC.
RL   Chinese Academy of Sciences, Chengdu Institute of Biology, P.O. Box 416,
RL   Chengdu, Sichuan 610041, China
XX
DR   MD5; e98beb3efa41f674b363ca45756f6249.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..284
FT                   /organism="Rosa chinensis var. spontanea"
FT                   /organelle="plastid:chloroplast"
FT                   /variety="spontanea"
FT                   /mol_type="genomic DNA"
FT                   /specimen_voucher="Quarryhill Botanical Garden 1988-237F"
FT                   /PCR_primers="fwd_name: psbAF, fwd_seq:
FT                   gttatgcatgaacgtaatgctc, rev_name: trnHR, rev_seq:
FT                   cgcgcatggtggattcacaaatc"
FT                   /db_xref="taxon:197613"
FT   misc_feature    1..284
FT                   /note="psbA-trnH intergenic spacer"
XX
SQ   Sequence 284 BP; 97 A; 23 C; 38 G; 126 T; 0 other;
     gactttggtc ttagtatata tgagttcgtg aaagttttga aagtaaagga gcaatactaa        60
     aattcttgtt atatcaagag gtttggtgtt gctcctttac catattactt taattattaa       120
     ttaaaattat tactataatt aaattagtat tttagtacta tttttttttt tactaaaaga       180
     ttaaaataaa agggtttcca tttatgttgt attctctttt acaagtaatg ataaatggtg       240
     gaaatatttg taatttctat ttttatttaa tttaaatagt acaa                        284
//