ID   JN936876; SV 1; linear; genomic DNA; STD; INV; 788 BP.
XX
AC   JN936876;
XX
DT   10-SEP-2012 (Rel. 114, Created)
DT   10-SEP-2012 (Rel. 114, Last updated, Version 1)
XX
DE   Proctophyllodes valchukae voucher AMUMD016 28S ribosomal RNA gene, partial
DE   sequence.
XX
KW   .
XX
OS   Proctophyllodes valchukae
OC   Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida; Acari;
OC   Acariformes; Sarcoptiformes; Astigmata; Psoroptidia; Analgoidea;
OC   Proctophyllodidae; Proctophyllodinae; Proctophyllodes.
XX
RN   [1]
RP   1-788
RA   Mironov S.V., Dabert J., Dabert M.;
RT   "A new feather mite species of the genus Proctophyllodes Robin, 1877
RT   (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus
RT   (Passeriformes: Aegithalidae) morphological description with DNA barcode
RT   data";
RL   Zootaxa 3253:54-61(2012).
XX
RN   [2]
RP   1-788
RA   Mironov S.V., Dabert J., Dabert M.;
RT   ;
RL   Submitted (25-OCT-2011) to the INSDC.
RL   Molecular Biology Techniques Laboratory, Faculty of Biology, Adam
RL   Mickiewicz University in Poznan, Umultowska 89, Poznan 61-614, Poland
XX
DR   MD5; c6ba0d09fbc01786dd49b90c186d362a.
DR   SILVA-LSU; JN936876.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..788
FT                   /organism="Proctophyllodes valchukae"
FT                   /host="Aegithalos caudatus (long-tailed tit)"
FT                   /mol_type="genomic DNA"
FT                   /specimen_voucher="AMUMD016"
FT                   /identified_by="S. V. Mironov"
FT                   /PCR_primers="fwd_name: 28SF0001, fwd_seq:
FT                   acccvcynaatttaagcatat, rev_name: 28SR0990, rev_seq:
FT                   ccttggtccgtgtttcaagac"
FT                   /db_xref="taxon:1229481"
FT   rRNA            <1..>788
FT                   /product="28S ribosomal RNA"
FT   misc_feature    376..768
FT                   /note="D2 region"
XX
SQ   Sequence 788 BP; 205 A; 149 C; 218 G; 216 T; 0 other;
     gggattccct tagtaacggc gagcgaaaag ggaaatgtcc agcgccaagt cttgacatgt        60
     ttgatgttca agagatgcgg cgttaatgta tcgacccatc atgcattgtt ctttgtttca       120
     agttcctacg accgggactt ccagagcggg tgtaagaccc atagagacga ggaaccagtg       180
     tatgctgagc gatgcattct agagtcaggt tgcttgagag tgcagcttaa agtcggtggt       240
     aaactccatc caagactaaa tattacagcg agaccgatag caaacaagta ccgtgaggga       300
     aagttgcaaa gcactttgaa gagagagttc aaaagtacgt gaaaccactg ggaggcaaac       360
     agatggaacc acgaagtttg cgtctcggtc gattcaatca tcactatttg tcaattgtca       420
     gtggtcagga tcttttagga ggttgacctt tggcaattct gatgaatggt gttggtgcat       480
     ttcgtgccgg gaatgctaag ccacgttcaa ctagagttgg gacggctgta agaaaggatc       540
     cgagaaaggt tgccgtcaag tgcttgcatt tgacggtgtt atagtcttgg atcggaaccg       600
     tcgcctaaca tactggttga tgaaaattct ccatttggag ttgaactata tctgcctgcg       660
     gttgttagtc gatgttgcgt aatgttcttt gcgtatcttt cgatgcgaaa aggctttgca       720
     aaaatgtcgg ctaatggctg tttgcgtgat atggtggaac tgtggcacga gtaggtcggt       780
     ctccatct                                                                788
//