ID JX999985; SV 1; linear; genomic DNA; STD; FUN; 234 BP. XX AC JX999985; XX DT 12-FEB-2013 (Rel. 115, Created) DT 12-FEB-2013 (Rel. 115, Last updated, Version 1) XX DE Sarcodon sp. NH-2013a isolate J17 internal transcribed spacer 1 and 5.8S DE ribosomal RNA gene, partial sequence. XX KW . XX OS Sarcodon sp. 'pseudoglaucopus' OC Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; OC Thelephorales; Thelephoraceae; Sarcodon; unclassified Sarcodon. XX RN [1] RP 1-234 RA Hogberg N., Nitare J.; RT "Swedish species of butchered Sarcodon-a preliminary report"; RL Sven Mykol Tidskr 0:0(2013). XX RN [2] RP 1-234 RA Hogberg N., Nitare J.; RT ; RL Submitted (24-OCT-2012) to the INSDC. RL Forest Mycology & Plant Pathology, Swedish University of Agricultural RL Sciences, Biocentre, Uppsala SE75000, Sweden XX DR MD5; 6b1b5f9052fdc25c67172b669d36938d. DR Unite; 371481. XX CC ##Assembly-Data-START## CC Assembly Method :: DNA STAR v. 2009 CC Sequencing Technology :: Sanger dideoxy sequencing CC ##Assembly-Data-END## XX FH Key Location/Qualifiers FH FT source 1..234 FT /organism="Sarcodon sp. 'pseudoglaucopus'" FT /isolate="J17" FT /mol_type="genomic DNA" FT /PCR_primers="fwd_name: its1f, fwd_seq: FT cttggtcatttagaggaagtaa, rev_name: its4, rev_seq: FT tcctccgcttattgatatgc" FT /db_xref="taxon:1284402" FT misc_RNA <1..>234 FT /note="contains internal transcribed spacer 1 and 5.8S FT ribosomal RNA" XX SQ Sequence 234 BP; 52 A; 52 C; 65 G; 65 T; 0 other; cgtttgggtt aagttggggg ttgttgctgg ttcttttggg catgtgcaca ccctgagtcc 60 ccgcgttccg agagcttttt tctcacccct gtgcgccccc tgtggagggg gaggagaaca 120 aaaaccctgg gtgtttaaag cgcctcctac aaaaattttt gacacacccc tttgtgaaag 180 attattggga agtgtgtgaa agcgccttct atggggcgaa aagaaaacaa cttt 234 //