Examples: histone, BN000065

Project: PRJNA549740

This project examines the bacterial and fungal communities of composted biosolids amended soil at Eagle's Pride Golf Course (47.0841° N, 122.6692° W). Composted biosolids were generated by Earthworks (owned by Joint Base Lewis-McChord in Washington state) using biosolids generated on the military base, along with yard-debris and pre-consumer food waste. Soil samples were collected June 2015, prior to treatment as a baseline measurement. Post-application samples were collected in April and September 2016. The bacterial community structure was assessed by sequencing the V3-V4 region of the 16S rRNA gene (amplicons were generated with the forward primer, CCTACGGGNGGCWGCAG, and the reverse primer, GACTACHVGGGTATCTAATCC). The fungal community structure was assessed by sequencing the ITS1f-ITS2 region of the ITS rRNA gene (the amplicons were generate using the forward primer, CTTGGTCATTTAGAGGAAGTAA, and the reverse primer, GCTGCGTTCTTCATCGATGC).

General