Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed. Overall design: KNS-42 cell line: parental, DDX3X codon optimized over expression, DDX3Y codon optimized over expression. Guide RNAs: 395 (targeting endogenous DDX3X) and AAVS1 (negative control).