› › Structure analysis

Coordinates of the A-site tRNA model fitted into the cryo-EM map of 70S ribosome in the pre-translocational state

Electron Microscopy
9Å resolution
PDB entry 1qzb coloured by chain, front view.
PDB entry 1qzb coloured by chain, side view.
PDB entry 1qzb coloured by chain, top view.
Source organism: Escherichia coli
Assembly composition:
monomeric (preferred)
Entry contents: 1 distinct RNA molecule

Quick links

Assemblies

Assembly 1 (preferred)
Download    3D Visualisation
Assembly Name: RNA
hide full assembly name
Multimeric state: monomeric
PDBe Complex ID: PDB-CPX-196183

Macromolecules

RNA chain B
Name: Phe-tRNA
Representative chains: B
Source organism: Escherichia coli [562]
Expression system: Not provided
Length: 76 nucleotides
Theoretical weight: 24.52 KDa
Phe-tRNA in PDB entry 1qzb, assembly 1, front view.
Phe-tRNA in PDB entry 1qzb, assembly 1, side view.
Phe-tRNA in PDB entry 1qzb, assembly 1, top view.
17610203040506070
 
204060GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA
Chains
Chain A (auth B)
Rfam
Molecule details ›

Search similar RNA

Quick links