2m93

Solution NMR

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Released:
Source organism: Synthetic construct
Primary publication:
Structural basis of DNA quadruplex-duplex junction formation.
Angew Chem Int Ed Engl 52 8566-9 (2013)
PMID: 23794476

Function and Biology Details

Biochemical function:
  • not assigned
Biological process:
  • not assigned
Cellular component:
  • not assigned

Structure analysis Details

Assembly composition:
monomeric (preferred)
Assembly name:
PDBe Complex ID:
PDB-CPX-115599 (preferred)
Entry contents:
1 distinct DNA molecule
Macromolecule:
32-MER DNA Chain: A
Molecule details ›
Chain: A
Length: 32 nucleotides
Theoretical weight: 10.07 KDa
Source organism: Synthetic construct
Expression system: Not provided

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

wwPDB Validation report is not available for this NMR entry.
Chemical shift assignment: 37%
Refinement method: DGSA-distance geometry simulated annealing, Distance-restrained molecular dynamics
Expression system: Not provided