› › RNA chains C, F

Class I ligase ribozyme

Class I ligase ribozyme in PDB entry 3r1h, assembly 2, front view.
Class I ligase ribozyme in PDB entry 3r1h, assembly 2, side view.
Class I ligase ribozyme in PDB entry 3r1h, assembly 2, top view.
Source organism: Homo sapiens [9606]
Expression system: Not provided
As chains: C, F
Length: 130 nucleotides
Theoretical weight: 42.1 KDa
FASTA Sequence
>pdb|3r1h|C F
GGAACACUAUACUACUGGAUAAUCAAAGACAAAUCUGCCCGAAGGGUUUGAGAACAUACCCAUUGCACUCCGGGUAUGCAGAGGUGGCAGCCUCCGGUGGGUUAAAACCCAACGUUCUCAACAAUAGUGA

Visualisation

1130102030405060708090100110120130
 
50100
Chains
RSRZ Outlier Chain C (auth C)
Chain C (auth C)
RSRZ Outlier Chain F (auth F)
Chain F (auth F)
Ligand binding sites
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA