› › RNA chain A

SGRNA

SGRNA in PDB entry 4un4, assembly 1, front view.
SGRNA in PDB entry 4un4, assembly 1, side view.
SGRNA in PDB entry 4un4, assembly 1, top view.
Source organism: synthetic construct [32630]
Expression system: Not provided
As chain: A
Length: 83 nucleotides
Theoretical weight: 26.79 KDa
FASTA Sequence
>pdb|4un4|A
GGAUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG

Visualisation

1831020304050607080
 
20406080GGAUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG
Chains
RSRZ Outlier Chain A (auth A)
Chain A (auth A)
Ligand binding sites
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA