› › DNA chains J, L

26-mer DNA segment containing the CarH operator sequence (sense strand)

26-mer DNA segment containing the CarH operator sequence (sense strand) in PDB entry 5c8e, assembly 1, front view.
26-mer DNA segment containing the CarH operator sequence (sense strand) in PDB entry 5c8e, assembly 1, side view.
26-mer DNA segment containing the CarH operator sequence (sense strand) in PDB entry 5c8e, assembly 1, top view.
Source organism: Thermus thermophilus HB27 [262724]
Expression system: Not provided
As chains: J, L
Length: 26 nucleotides
Theoretical weight: 7.97 KDa
FASTA Sequence
>pdb|5c8e|J L
ATGTACAAAAGCTTGACAAAACCTAT

Visualisation

Quick links

Search similar DNA