› › DNA chain V

DNA (5'-D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3')

DNA (5'-D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') in PDB entry 5dfj, assembly 1, front view.
DNA (5'-D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') in PDB entry 5dfj, assembly 1, side view.
DNA (5'-D(*GP*GP*AP*TP*CP*CP*GP*TP*CP*GP*GP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3') in PDB entry 5dfj, assembly 1, top view.
Source organism: synthetic construct [32630]
Expression system: Not provided
As chain: V
Length: 21 nucleotides
Theoretical weight: 6.47 KDa
FASTA Sequence
>pdb|5dfj|V
GGATCCGTCGGGCGCATCAGC

Visualisation

1212468101214161820
 
5101520GGATCCGTCGGGCGCATCAGC
Chains
RSRZ Outlier Chain D (auth V)
Chain D (auth V)
Ligand binding sites
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA