› › RNA chains 4K, 4L

Messenger RNA

Messenger RNA in PDB entry 5el5, assembly 1, front view.
Messenger RNA in PDB entry 5el5, assembly 1, side view.
Messenger RNA in PDB entry 5el5, assembly 1, top view.
As chains: 4K, 4L
Length: 27 nucleotides
Theoretical weight: 8.86 KDa
FASTA Sequence
>pdb|5el5|4K 4L
GGCAAGGAGGUAAAAAUGAUAAAAAAA

Visualisation

1272468101214161820222426
 
1020GGCAAGGAGGUAAAAAUGAUAAAAAAA
Chains
RSRZ Outlier Chain BC (auth 4L)
Chain BC (auth 4L)
RSRZ Outlier Chain Y (auth 4K)
Chain Y (auth 4K)
Ligand binding sites

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA