› › DNA chain T

template DNA

template DNA in PDB entry 5n61, assembly 1, front view.
template DNA in PDB entry 5n61, assembly 1, side view.
template DNA in PDB entry 5n61, assembly 1, top view.
As chain: T
Length: 47 nucleotides
Theoretical weight: 13.76 KDa
FASTA Sequence
>pdb|5n61|T
TTGTCTTCAACTGCTTTCGCGNNNNNATGCATGCATGCATGCATGCA

Visualisation

14751015202530354045
 
2040TTGTCTTCAACTGCTTTCGCG*****ATGCATGCATGCATGCATGCA
Chains
Chain T (auth T)

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA