› › DNA chain F

Non-Template promoter DNA

Non-Template promoter DNA in PDB entry 5nsr, assembly 1, front view.
Non-Template promoter DNA in PDB entry 5nsr, assembly 1, side view.
Non-Template promoter DNA in PDB entry 5nsr, assembly 1, top view.
As chain: F
Length: 63 nucleotides
Theoretical weight: 19.4 KDa
FASTA Sequence
>pdb|5nsr|F
ACATGAATGCGCAACAGCATGCGCGCCCAGGGCTGATCGTGCAAAAGTCGTGCCAGCCGTCTC

Visualisation

16351015202530354045505560
 
204060ACATGAATGCGCAACAGCATGCGCGCCCAGGGCTGATCGTGCAAAAGTCGTGCCAGCCGTCTC
Chains
Chain G (auth F)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA