› › DNA chain N

Nontarget strand

Nontarget strand in PDB entry 6c66, assembly 1, front view.
Nontarget strand in PDB entry 6c66, assembly 1, side view.
Nontarget strand in PDB entry 6c66, assembly 1, top view.
As chain: N
Length: 55 nucleotides
Theoretical weight: 17.1 KDa
FASTA Sequence
>pdb|6c66|N
CGCGCGGACGAAGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCGCCTGGACGC

Visualisation

155510152025303540455055
 
2040CGCGCGGACGAAGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCGCCTGGACGC
Chains
Chain N (auth N)
Ligand binding sites
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA