› › DNA chains E, G

Forward strand of substrate RSS DNA

Forward strand of substrate RSS DNA in PDB entry 6dbo, assembly 1, front view.
Forward strand of substrate RSS DNA in PDB entry 6dbo, assembly 1, side view.
Forward strand of substrate RSS DNA in PDB entry 6dbo, assembly 1, top view.
As chains: E, G
Length: 32 nucleotides
Theoretical weight: 9.82 KDa
FASTA Sequence
>pdb|6dbo|E G
GATCTGGCCTGTCTTACACAGTGGTAGTACTC

Visualisation

Quick links

Search similar DNA