› › RNA chain B

RNA (110-MER)

RNA (110-MER) in PDB entry 6ny2, assembly 1, front view.
RNA (110-MER) in PDB entry 6ny2, assembly 1, side view.
RNA (110-MER) in PDB entry 6ny2, assembly 1, top view.
Source organism: Deltaproteobacteria bacterium [2026735]
Expression system: Not provided
As chain: B
Length: 122 nucleotides
Theoretical weight: 39.27 KDa
FASTA Sequence
>pdb|6ny2|B
GGCGCGUUUAUUCCAUUACUUUGGAGCCAGUCCCAGCGACUAUGUCGUAUGGACGAAGCGCUUAUUUAUCGGAGAGAAACCGAUAAGUAAAACGCAUCAAAGUCCUGCAGCAGAAAAUCAAA

Visualisation

1122102030405060708090100110120
 
50100
Chains
Chain D (auth B)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA