› › DNA chain X

DNA (65-MER)

DNA (65-MER) in PDB entry 6o9l, assembly 1, front view.
DNA (65-MER) in PDB entry 6o9l, assembly 1, side view.
DNA (65-MER) in PDB entry 6o9l, assembly 1, top view.
As chain: X
Length: 65 nucleotides
Theoretical weight: 20.21 KDa
FASTA Sequence
>pdb|6o9l|X
GAAGGGCGCCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCG

Visualisation

1655101520253035404550556065
 
204060GAAGGGCGCCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCG
Chains
Chain FA (auth X)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA