› › DNA chain J

DNA (145-MER)

DNA (145-MER) in PDB entry 6se6, assembly 1, front view.
DNA (145-MER) in PDB entry 6se6, assembly 1, side view.
DNA (145-MER) in PDB entry 6se6, assembly 1, top view.
As chain: J
Length: 145 nucleotides
Theoretical weight: 44.99 KDa
FASTA Sequence
>pdb|6se6|J
ATCGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTGAT

Visualisation

114520406080100120140
 
50100
Chains
Chain J (auth J)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA