› › DNA chains K1, M1

matS2 DNA 80 b, oligo FBA769

matS2 DNA 80 b, oligo FBA769 in PDB entry 7nz3, assembly 1, front view.
matS2 DNA 80 b, oligo FBA769 in PDB entry 7nz3, assembly 1, side view.
matS2 DNA 80 b, oligo FBA769 in PDB entry 7nz3, assembly 1, top view.
As chains: K1, M1
Length: 80 nucleotides
Theoretical weight: 24.63 KDa
FASTA Sequence
>pdb|7nz3|K1 M1
CTCGCCTGTAAAGTAGGCATTAGTTGTTCGTAGTGCTCGTCTGGCTCTGGATTACCCGCCACTGTTACATTGTAACGGCA

Visualisation

1801020304050607080
 
20406080CTCGCCTGTAAAGTAGGCATTAGTTGTTCGTAGTGCTCGTCTGGCTCTGGATTACCCGCCACTGTTACATTGTAACGGCA
Chains
Chain U (auth K1)
Chain W (auth M1)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA