› › RNA chain z

mitochondrial tRNA

mitochondrial tRNA in PDB entry 7oid, assembly 1, front view.
mitochondrial tRNA in PDB entry 7oid, assembly 1, side view.
mitochondrial tRNA in PDB entry 7oid, assembly 1, top view.
As chain: z
Length: 73 nucleotides
Theoretical weight: 23.38 KDa
FASTA Sequence
>pdb|7oid|z
AGUUAUGUAGCUUAAAUUAUCAAAGCAAGGCACUGAAAAUGCCUAGAUGAGCCUCACAGCUCCAUUAACACCA

Visualisation

Loading Protvista...

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA