› › DNA chain D

DNA (36-MER)

DNA (36-MER) in PDB entry 8hhm, assembly 1, front view.
DNA (36-MER) in PDB entry 8hhm, assembly 1, side view.
DNA (36-MER) in PDB entry 8hhm, assembly 1, top view.
Source organism: Mycolicibacterium mucogenicum [56689]
Expression system: Not provided
As chain: D
Length: 36 nucleotides
Theoretical weight: 11.18 KDa
FASTA Sequence
>pdb|8hhm|D
TGTCTATTTGGGAGATGAGGTGCGCGTGGCACCATC

Visualisation

1365101520253035
 
102030TGTCTATTTGGGAGATGAGGTGCGCGTGGCACCATC
Chains
Chain C (auth D)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA