› › DNA chain C

DNA (47-MER)

DNA (47-MER) in PDB entry 8ojb, assembly 1, front view.
DNA (47-MER) in PDB entry 8ojb, assembly 1, side view.
DNA (47-MER) in PDB entry 8ojb, assembly 1, top view.
Source organism: synthetic construct [32630]
Expression system: Not provided
As chain: C
Length: 47 nucleotides
Theoretical weight: 14.26 KDa
FASTA Sequence
>pdb|8ojb|C
GCCACTACGACACCTTGATCGCCTCGCAGCCGTCCAACCAACTCAAA

Visualisation

14751015202530354045
 
2040GCCACTACGACACCTTGATCGCCTCGCAGCCGTCCAACCAACTCAA*
Chains
Chain A (auth C)
Ligand binding sites
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA