› › RNA chain B

RNA (39-MER)

RNA (39-MER) in PDB entry 8sfp, assembly 1, front view.
RNA (39-MER) in PDB entry 8sfp, assembly 1, side view.
RNA (39-MER) in PDB entry 8sfp, assembly 1, top view.
Source organism: synthetic construct [32630]
Expression system: Not provided
As chain: B
Length: 48 nucleotides
Theoretical weight: 15.35 KDa
FASTA Sequence
>pdb|8sfp|B
UUUUUAAUUUCUACUCUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGA

Visualisation

14851015202530354045
 
2040UUUUUAAUUUCUACUCUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGA
Chains
Chain B (auth B)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA