› › DNA chain N

Non-template DNA

Non-template DNA in PDB entry 8uhg, assembly 1, front view.
Non-template DNA in PDB entry 8uhg, assembly 1, side view.
Non-template DNA in PDB entry 8uhg, assembly 1, top view.
As chain: N
Length: 50 nucleotides
Theoretical weight: 15.41 KDa
FASTA Sequence
>pdb|8uhg|N
GGTCAGTACGTCCGGCATAGTTGCGCCCGTAAATTCAGATCTTCCAGTGG

Visualisation

1505101520253035404550
 
2040GGTCAGTACGTCCGGCATAGTTGCGCCCGTAAATTCAGATCTTCCAGTGG
Chains
Chain P (auth N)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA