› › RNA chains 1y, 2y

Deacylated tRNAphe

Deacylated tRNAphe in PDB entry 8vtx, assembly 2, front view.
Deacylated tRNAphe in PDB entry 8vtx, assembly 2, side view.
Deacylated tRNAphe in PDB entry 8vtx, assembly 2, top view.
As chains: 1y, 2y
Length: 76 nucleotides
Theoretical weight: 24.64 KDa
FASTA Sequence
>pdb|8vtx|1y 2y
GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGGGCACCA

Visualisation

17610203040506070
 
204060GCCCGGA*AGCUCAGUCGGUAGAGCAGGGGA*UGAA*A*CCCCGU*UCCUUGG**CGAUUCCGAGUCCGGGCACCA
Chains
RSRZ Outlier Chain DB (auth 1y)
Chain DB (auth 1y)
RSRZ Outlier Chain HD (auth 2y)
Chain HD (auth 2y)
Rfam
Ligand binding sites

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA