› › RNA chains C, D, G, H

Circular RNA

Circular RNA in PDB entry 9h86, assembly 1, front view.
Circular RNA in PDB entry 9h86, assembly 1, side view.
Circular RNA in PDB entry 9h86, assembly 1, top view.
Source organism: synthetic construct [32630]
Expression system: synthetic construct [32630]
As chains: C, D, G, H
Length: 36 nucleotides
Theoretical weight: 11.19 KDa
FASTA Sequence
>pdb|9h86|C D G H
AUCUUCUUCGAUUUCUUCCAGUUCUUCGCGUUCUUC

Visualisation

1365101520253035
 
102030AUCUUCUUCGAUUUCUUCCAGUUCUUCGCGUUCUUC
Chains
Chain B (auth D)
Chain C (auth C)
Chain F (auth H)
Chain G (auth G)

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA