› › RNA chain B

5S ribosomal RNA

5S ribosomal RNA in PDB entry 5gae, assembly 1, front view.
5S ribosomal RNA in PDB entry 5gae, assembly 1, side view.
5S ribosomal RNA in PDB entry 5gae, assembly 1, top view.
As chain: B
Length: 120 nucleotides
Theoretical weight: 38.79 KDa
FASTA Sequence
>pdb|5gae|B
UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU

Visualisation

Loading Protvista...

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA