› › RNA chain B

RNA (40-MER)

RNA (40-MER) in PDB entry 6gtg, assembly 1, front view.
RNA (40-MER) in PDB entry 6gtg, assembly 1, side view.
RNA (40-MER) in PDB entry 6gtg, assembly 1, top view.
Source organism: Francisella tularensis subsp. novicida U112 [401614]
Expression system: Not provided
As chain: B
Length: 43 nucleotides
Theoretical weight: 13.75 KDa
FASTA Sequence
>pdb|6gtg|B
AAUUUCUACUGUUGUAGAUGAGAAGUCAUUUAAUAAGGCCACU

Visualisation

Loading Protvista...

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA