› › Structure analysis

Human thymine DNA glycosylase bound to DNA with 2'-F-5-carboxyl-dC substrate analog

X-ray diffraction
1.55Å resolution
PDB entry 6u17 coloured by chain, front view.
PDB entry 6u17 coloured by chain, side view.
PDB entry 6u17 coloured by chain, top view.
Source organisms:
Assembly composition:
hetero trimer (preferred)
Entry contents: 1 distinct polypeptide molecule
2 distinct DNA molecules

Quick links

Assemblies

Assembly 1 (preferred)
Download    3D Visualisation
Assembly Name: G/T mismatch-specific thymine DNA glycosylase and DNA
hide full assembly name
Multimeric state: hetero trimer
Accessible surface area: 17768.17 Å2
Buried surface area: 5483.95 Å2
Dissociation area: 1,745.79 Å2
Dissociation energy (ΔGdiss): 50.88 kcal/mol
Dissociation entropy (TΔSdiss): 12.39 kcal/mol
Symmetry number: 1
PDBe Complex ID: PDB-CPX-120669

Macromolecules

G/T mismatch-specific thymine DNA glycosylase
Chain: A
Length: 227 amino acids
Theoretical weight: 25.88 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli BL21(DE3)
UniProt:
  • Canonical: Q13569 (Residues: 82-308; Coverage: 55%)
Gene name: TDG
Pfam: Uracil DNA glycosylase superfamily
InterPro:
G/T mismatch-specific thymine DNA glycosylase in PDB entry 6u17, assembly 1, front view.
G/T mismatch-specific thymine DNA glycosylase in PDB entry 6u17, assembly 1, side view.
G/T mismatch-specific thymine DNA glycosylase in PDB entry 6u17, assembly 1, top view.
PDBe-KB: UniProt Coverage View: Q13569  
122720406080100120140160180200220
 
100200
UniProt
Q13569
Chains
Domains
Flexibility predictions
Ligand binding sites
Molecule details ›

Search similar proteins

DNA chain C
Name: DNA (28-MER)
Representative chains: C
Source organism: synthetic construct [32630]
Expression system: Not provided
Length: 28 nucleotides
Theoretical weight: 8.65 KDa
DNA (28-MER) in PDB entry 6u17, assembly 1, front view.
DNA (28-MER) in PDB entry 6u17, assembly 1, side view.
DNA (28-MER) in PDB entry 6u17, assembly 1, top view.
128246810121416182022242628
 
1020CAGCTCTGTACGTGAGCGATGGACAGCT
Chains
Chain B (auth C)
Interaction interfaces
Molecule details ›

Search similar DNA

DNA chain D
Name: DNA (30-MER)
Representative chains: D
Source organism: synthetic construct [32630]
Expression system: Not provided
Length: 28 nucleotides
Theoretical weight: 8.63 KDa
DNA (30-MER) in PDB entry 6u17, assembly 1, front view.
DNA (30-MER) in PDB entry 6u17, assembly 1, side view.
DNA (30-MER) in PDB entry 6u17, assembly 1, top view.
128246810121416182022242628
 
1020AGCTGTCCATCGCTCA*GTACAGAGCTG
Chains
Chain C (auth D)
Interaction interfaces
Molecule details ›

Search similar DNA

Quick links