› › DNA chains J, M

DNA (25-MER)

DNA (25-MER) in PDB entry 6voy, assembly 1, front view.
DNA (25-MER) in PDB entry 6voy, assembly 1, side view.
DNA (25-MER) in PDB entry 6voy, assembly 1, top view.
As chains: J, M
Length: 25 nucleotides
Theoretical weight: 7.61 KDa
FASTA Sequence
>pdb|6voy|J M
ACTGTGTACTAAATTTCTCTCCTGG

Visualisation

12524681012141618202224
 
1020ACTGTGTACTAAATTTCTCTCCTGG
Chains
Chain H (auth J)
Chain K (auth M)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA