RNA chain 6A

U6 snRNA

As chain: 6A
Length: 107 nucleotides
Theoretical weight: 34.4 KDa
Rfam:
FASTA Sequence
>pdb|8h6e|6A
GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU

Visualisation

Loading Protvista...

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.