› › RNA chains I, J

RNA (65-MER)

RNA (65-MER) in PDB entry 8kai, assembly 1, front view.
RNA (65-MER) in PDB entry 8kai, assembly 1, side view.
RNA (65-MER) in PDB entry 8kai, assembly 1, top view.
Source organism: Streptococcus pyogenes serotype M1 [301447]
Expression system: Escherichia coli DH5[alpha] [668369]
As chains: I, J
Length: 65 nucleotides
Theoretical weight: 20.97 KDa
FASTA Sequence
>pdb|8kai|I J
GGUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUC

Visualisation

1655101520253035404550556065
 
204060GGUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUC
Chains
Chain I (auth I)
Chain J (auth J)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA