› › Structure analysis

Human DNA polymerase epsilon bound to DNA and PCNA (closed conformation)

Electron Microscopy
3.75Å resolution
PDB entry 9f6f coloured by chain, front view.
PDB entry 9f6f coloured by chain, side view.
PDB entry 9f6f coloured by chain, top view.
Source organism: Homo sapiens
Assembly composition:
hetero hexamer (preferred)
Entry contents: 2 distinct polypeptide molecules
2 distinct DNA molecules

Quick links

Assemblies

Assembly 1 (preferred)
Download    3D Visualisation
Assembly Name: PCNA homotrimer and DNA polymerase epsilon catalytic subunit A and DNA
hide full assembly name
Multimeric state: hetero hexamer
Accessible surface area: 96824.68 Å2
Buried surface area: 15750.11 Å2
Dissociation area: 4,342.81 Å2
Dissociation energy (ΔGdiss): 22.18 kcal/mol
Dissociation entropy (TΔSdiss): 42.88 kcal/mol
Symmetry number: 1
PDBe Complex ID: PDB-CPX-271066

Macromolecules

DNA polymerase epsilon catalytic subunit A
Chain: A
Length: 1200 amino acids
Theoretical weight: 138.14 KDa
Source organism: Homo sapiens
Expression system: Trichoplusia ni
UniProt:
  • Canonical: Q07864 (Residues: 1-1200; Coverage: 53%)
Gene names: POLE, POLE1
Pfam:
DNA polymerase epsilon catalytic subunit A in PDB entry 9f6f, assembly 1, front view.
DNA polymerase epsilon catalytic subunit A in PDB entry 9f6f, assembly 1, side view.
DNA polymerase epsilon catalytic subunit A in PDB entry 9f6f, assembly 1, top view.
PDBe-KB: UniProt Coverage View: Q07864  
112001002003004005006007008009001,0001,1001,200
 
5001000
UniProt
Q07864
Chains
Secondary structure
Flexibility predictions
Ligand binding sites
Interaction interfaces
Molecule details ›

Search similar proteins

Proliferating cell nuclear antigen
Chains: B, C, D
Length: 261 amino acids
Theoretical weight: 28.8 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli BL21(DE3)
UniProt:
  • Canonical: P12004 (Residues: 1-261; Coverage: 100%)
Gene name: PCNA
Pfam:
Proliferating cell nuclear antigen in PDB entry 9f6f, assembly 1, front view.
Proliferating cell nuclear antigen in PDB entry 9f6f, assembly 1, side view.
Proliferating cell nuclear antigen in PDB entry 9f6f, assembly 1, top view.
PDBe-KB: UniProt Coverage View: P12004  
126120406080100120140160180200220240260
 
100200
UniProt
P12004
Chains
Secondary structure
Interaction interfaces
Molecule details ›

Search similar proteins

DNA chain P
Name: DNA nascent strand
Representative chains: P
Length: 24 nucleotides
Theoretical weight: 7.07 KDa
DNA nascent strand in PDB entry 9f6f, assembly 1, front view.
DNA nascent strand in PDB entry 9f6f, assembly 1, side view.
DNA nascent strand in PDB entry 9f6f, assembly 1, top view.
12424681012141618202224
 
1020CCTTCCACTTCCCAACCCTCACC*
Chains
Chain E (auth P)
Ligand binding sites
Interaction interfaces
Molecule details ›

Search similar DNA

DNA chain T
Name: DNA template strand
Representative chains: T
Length: 38 nucleotides
Theoretical weight: 12.03 KDa
DNA template strand in PDB entry 9f6f, assembly 1, front view.
DNA template strand in PDB entry 9f6f, assembly 1, side view.
DNA template strand in PDB entry 9f6f, assembly 1, top view.
1385101520253035
 
102030AAGGCTGAACGAATTGGTGAGGGTTGGGAAGTGGAAGG
Chains
Chain F (auth T)
Ligand binding sites
Interaction interfaces
Molecule details ›

Search similar DNA

Quick links