› › RNA chain I

Intron of UBC4 pre-mRNA

Intron of UBC4 pre-mRNA in PDB entry 5lj3, assembly 1, front view.
Intron of UBC4 pre-mRNA in PDB entry 5lj3, assembly 1, side view.
Intron of UBC4 pre-mRNA in PDB entry 5lj3, assembly 1, top view.
As chain: I
Length: 76 nucleotides
Theoretical weight: 24.11 KDa
FASTA Sequence
>pdb|5lj3|I
GUAUGUCUAAAGUUAUGGCCACGUUUCAAAUGCGUGCUUUUUUUUUAAAACUUAUGCUCUUAUUUACUAACAAAAU

Visualisation

Quick links

Search similar RNA