› › RNA chain I

Intron of UBC4 pre-mRNA

Intron of UBC4 pre-mRNA in PDB entry 5lj3, assembly 1, front view.
Intron of UBC4 pre-mRNA in PDB entry 5lj3, assembly 1, side view.
Intron of UBC4 pre-mRNA in PDB entry 5lj3, assembly 1, top view.
As chain: I
Length: 76 nucleotides
Theoretical weight: 24.11 KDa
FASTA Sequence
>pdb|5lj3|I
GUAUGUCUAAAGUUAUGGCCACGUUUCAAAUGCGUGCUUUUUUUUUAAAACUUAUGCUCUUAUUUACUAACAAAAU

Visualisation

17610203040506070
 
204060GUAUGUCUAAAGUUAUGGCCACGUUUCAAAUGCGUGCUUUUUUUUUAAAACUUAUGCUCUUAUUUACUAACAAAAU
Chains
Chain C (auth I)
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar RNA