› › DNA chain C

FANCF off-target3 target strand

FANCF off-target3 target strand in PDB entry 7qqv, assembly 1, front view.
FANCF off-target3 target strand in PDB entry 7qqv, assembly 1, side view.
FANCF off-target3 target strand in PDB entry 7qqv, assembly 1, top view.
Source organism: synthetic construct [32630]
Expression system: Not provided
As chain: C
Length: 28 nucleotides
Theoretical weight: 8.66 KDa
FASTA Sequence
>pdb|7qqv|C
CAATACCGGGTCTGCAGAAGGGGCTCCG

Visualisation

128246810121416182022242628
 
1020CAATACCGGGTCTGCAGAAGGGGCTCCG
Chains
Chain C (auth C)
Ligand binding sites
Interaction interfaces

WebGL does not seem to be available.

This can be caused by an outdated browser, graphics card driver issue, or bad weather. Sometimes, just restarting the browser helps. Also, make sure hardware acceleration is enabled in your browser.

For a list of supported browsers, refer to http://caniuse.com/#feat=webgl.

Quick links

Search similar DNA